px459v2 plasmid (Addgene inc)
Structured Review
Px459v2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2902 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459v2+0/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm41844711-210-13-16
Average 96 stars, based on 2902 article reviews
Images
Related Articles
CRISPR:Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons. Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool (http://crispr.mit.edu; Table S2) and cloned into Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool ( http://crispr.mit.edu ; Supplemental Table 2) and cloned into Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool ( http://crispr.mit.edu; ) and cloned into Clone Assay:Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons. Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool (http://crispr.mit.edu; Table S2) and cloned into Article Title: Mitochondrial elongation impairs breast cancer metastasis Article Snippet: The GEMb facility is supported by CFI-36490, CFI-37607, and CFI-36940. pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from F. Zhang (Addgene plasmid no. 62988; http://n2t.net/addgene:62988 ; RRID:Addgene_62988). plenti-Cas9-Blast was a gift from F. Zhang (Addgene plasmid no. 52962; http://n2t.net/addgene:52962 ; RRID:Addgene_52962). .. For generating 4T1 fission KOs, guides targeting each gene ( Dnm1l , Fis1 , and Mff ) were cloned into Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool ( http://crispr.mit.edu ; Supplemental Table 2) and cloned into Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool ( http://crispr.mit.edu; ) and cloned into Article Title: Microfluidic devices and methods of use Article Snippet: .. For single-cell knock-out clones (HAP1 only), sgRNAs were cloned into modified Article Title: Identification of proximal SUMO-dependent interactors using SUMO-ID Article Snippet: To target EYFP into the first coding exon, shared by most PML isoforms, an sgRNA target site was chosen (CTGCACCCGCCCGATCTCCG) using Broad institute GPP sgRNA Designer . .. Custom oligos were cloned into Construct:Article Title: Role of the Orphan Transporter SLC35E1 in the Nuclear Egress of Herpes Simplex Virus 1. Article Snippet: .. Plasmids. pBS-SEM-KanS was constructed by cloning a kanamycin resistance cassette and the I-SceI recognition site, amplified by PCR from pEPkan-S (71) using primers that additionally encode the tandem strep epitopes-TEV protease cleavage site, 59-GCGAATTCATGGCTAGCTGGAGCCACCCGCAGTTCGA GAAAGGTGGAGGTGCCCGAGGTGGATCGGGAGGTGGATCGTGGAGCCACCCGCAGTTCGAAAAAGGAGGAGG ATGACGACGATAAGTAGGG-39 and 59-GCGTCGACCAAGTCCTCTTCAGAAATGAGCTTTTGCTCACCCTGAAA ATACAAATTCTCTGAACCTCCTTTTTCGAACTGCGGGTGGCTCCACGATCCACCTCCAACCAATTAACCAATTCTG ATTAG-39 into pBluescript II KS(1) (Stratagene). pRetroX-TRE3G-hSpCas9 was constructed by cloning the hSpCas9 open reading frame (ORF), amplified by PCR from Cloning:Article Title: Role of the Orphan Transporter SLC35E1 in the Nuclear Egress of Herpes Simplex Virus 1. Article Snippet: .. Plasmids. pBS-SEM-KanS was constructed by cloning a kanamycin resistance cassette and the I-SceI recognition site, amplified by PCR from pEPkan-S (71) using primers that additionally encode the tandem strep epitopes-TEV protease cleavage site, 59-GCGAATTCATGGCTAGCTGGAGCCACCCGCAGTTCGA GAAAGGTGGAGGTGCCCGAGGTGGATCGGGAGGTGGATCGTGGAGCCACCCGCAGTTCGAAAAAGGAGGAGG ATGACGACGATAAGTAGGG-39 and 59-GCGTCGACCAAGTCCTCTTCAGAAATGAGCTTTTGCTCACCCTGAAA ATACAAATTCTCTGAACCTCCTTTTTCGAACTGCGGGTGGCTCCACGATCCACCTCCAACCAATTAACCAATTCTG ATTAG-39 into pBluescript II KS(1) (Stratagene). pRetroX-TRE3G-hSpCas9 was constructed by cloning the hSpCas9 open reading frame (ORF), amplified by PCR from Amplification:Article Title: Role of the Orphan Transporter SLC35E1 in the Nuclear Egress of Herpes Simplex Virus 1. Article Snippet: .. Plasmids. pBS-SEM-KanS was constructed by cloning a kanamycin resistance cassette and the I-SceI recognition site, amplified by PCR from pEPkan-S (71) using primers that additionally encode the tandem strep epitopes-TEV protease cleavage site, 59-GCGAATTCATGGCTAGCTGGAGCCACCCGCAGTTCGA GAAAGGTGGAGGTGCCCGAGGTGGATCGGGAGGTGGATCGTGGAGCCACCCGCAGTTCGAAAAAGGAGGAGG ATGACGACGATAAGTAGGG-39 and 59-GCGTCGACCAAGTCCTCTTCAGAAATGAGCTTTTGCTCACCCTGAAA ATACAAATTCTCTGAACCTCCTTTTTCGAACTGCGGGTGGCTCCACGATCCACCTCCAACCAATTAACCAATTCTG ATTAG-39 into pBluescript II KS(1) (Stratagene). pRetroX-TRE3G-hSpCas9 was constructed by cloning the hSpCas9 open reading frame (ORF), amplified by PCR from Polymerase Chain Reaction:Article Title: Role of the Orphan Transporter SLC35E1 in the Nuclear Egress of Herpes Simplex Virus 1. Article Snippet: .. Plasmids. pBS-SEM-KanS was constructed by cloning a kanamycin resistance cassette and the I-SceI recognition site, amplified by PCR from pEPkan-S (71) using primers that additionally encode the tandem strep epitopes-TEV protease cleavage site, 59-GCGAATTCATGGCTAGCTGGAGCCACCCGCAGTTCGA GAAAGGTGGAGGTGCCCGAGGTGGATCGGGAGGTGGATCGTGGAGCCACCCGCAGTTCGAAAAAGGAGGAGG ATGACGACGATAAGTAGGG-39 and 59-GCGTCGACCAAGTCCTCTTCAGAAATGAGCTTTTGCTCACCCTGAAA ATACAAATTCTCTGAACCTCCTTTTTCGAACTGCGGGTGGCTCCACGATCCACCTCCAACCAATTAACCAATTCTG ATTAG-39 into pBluescript II KS(1) (Stratagene). pRetroX-TRE3G-hSpCas9 was constructed by cloning the hSpCas9 open reading frame (ORF), amplified by PCR from Single Cell:Article Title: Microfluidic devices and methods of use Article Snippet: .. For single-cell knock-out clones (HAP1 only), sgRNAs were cloned into modified Knock-Out:Article Title: Microfluidic devices and methods of use Article Snippet: .. For single-cell knock-out clones (HAP1 only), sgRNAs were cloned into modified Modification:Article Title: Microfluidic devices and methods of use Article Snippet: .. For single-cell knock-out clones (HAP1 only), sgRNAs were cloned into modified Sequencing:Article Title: Microfluidic devices and methods of use Article Snippet: .. For single-cell knock-out clones (HAP1 only), sgRNAs were cloned into modified Plasmid Preparation:Article Title: Highly efficient prime editors for mammalian genome editing based on porcine retrovirus reverse transcriptase. Article Snippet: Weiwei Liu (刘为伟), Wenxin Duan (段 文鑫), Zhiwei Peng (彭志伟), Yaya Liao (廖丫丫), Xiaoguo Wang (王晓果), Ruirong Liu (刘睿容), Qiqi Jing (景琦 琦), Haoyun Jiang (江浩筠), Yuhang Fan (樊煜航), Liming Ge (葛黎明), Lusheng Huang (黄路生), Yuyun Xing (幸宇云) wwliu199@outlook.com (W. Liu), lushenghuang@hotmail.com (L. Huang) xingyuyun9@hotma il.com (Y. Xing).. Trends in Biotechnology, Month 2025, Vol. xx, No. xx https://doi.org/10.1016/j.tibtech.2025.07.029 TIBTEC 2779 No. of Pages 25 OPEN ACCESS Trends in Biotechnology |
