Review



px459v2 plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc px459v2 plasmid
    Px459v2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2902 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459v2+0/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm41844711-210-13-16
    Average 96 stars, based on 2902 article reviews
    px459v2 plasmid - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons.
    Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool (http://crispr.mit.edu; Table S2) and cloned into pX459v2.0 (Addgene 62988) vector. ..

    Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons
    Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool ( http://crispr.mit.edu ; Supplemental Table 2) and cloned into pX459v2.0 (Addgene 62988) vector. ..

    Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons
    Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool ( http://crispr.mit.edu; ) and cloned into pX459v2.0 (Addgene 62988) vector. ..

    Clone Assay:

    Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons.
    Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool (http://crispr.mit.edu; Table S2) and cloned into pX459v2.0 (Addgene 62988) vector. ..

    Article Title: Mitochondrial elongation impairs breast cancer metastasis
    Article Snippet: The GEMb facility is supported by CFI-36490, CFI-37607, and CFI-36940. pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from F. Zhang (Addgene plasmid no. 62988; http://n2t.net/addgene:62988 ; RRID:Addgene_62988). plenti-Cas9-Blast was a gift from F. Zhang (Addgene plasmid no. 52962; http://n2t.net/addgene:52962 ; RRID:Addgene_52962). .. For generating 4T1 fission KOs, guides targeting each gene ( Dnm1l , Fis1 , and Mff ) were cloned into PX459v2.0 (Addgene: 62988). ..

    Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons
    Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool ( http://crispr.mit.edu ; Supplemental Table 2) and cloned into pX459v2.0 (Addgene 62988) vector. ..

    Article Title: The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons
    Article Snippet: .. Next, sgRNAs targeting GOLGA8, SNORD116, and SNORD115 were designed using MIT’s CRISPR Design Tool ( http://crispr.mit.edu; ) and cloned into pX459v2.0 (Addgene 62988) vector. ..

    Article Title: Microfluidic devices and methods of use
    Article Snippet: .. For single-cell knock-out clones (HAP1 only), sgRNAs were cloned into modified PX459v2.0 (from Addgene #62988, 1 kb stuffer sequence added). ..

    Article Title: Identification of proximal SUMO-dependent interactors using SUMO-ID
    Article Snippet: To target EYFP into the first coding exon, shared by most PML isoforms, an sgRNA target site was chosen (CTGCACCCGCCCGATCTCCG) using Broad institute GPP sgRNA Designer . .. Custom oligos were cloned into px459v2.0 (a kind gift of F. Zhang; Addgene #62988). ..

    Construct:

    Article Title: Role of the Orphan Transporter SLC35E1 in the Nuclear Egress of Herpes Simplex Virus 1.
    Article Snippet: .. Plasmids. pBS-SEM-KanS was constructed by cloning a kanamycin resistance cassette and the I-SceI recognition site, amplified by PCR from pEPkan-S (71) using primers that additionally encode the tandem strep epitopes-TEV protease cleavage site, 59-GCGAATTCATGGCTAGCTGGAGCCACCCGCAGTTCGA GAAAGGTGGAGGTGCCCGAGGTGGATCGGGAGGTGGATCGTGGAGCCACCCGCAGTTCGAAAAAGGAGGAGG ATGACGACGATAAGTAGGG-39 and 59-GCGTCGACCAAGTCCTCTTCAGAAATGAGCTTTTGCTCACCCTGAAA ATACAAATTCTCTGAACCTCCTTTTTCGAACTGCGGGTGGCTCCACGATCCACCTCCAACCAATTAACCAATTCTG ATTAG-39 into pBluescript II KS(1) (Stratagene). pRetroX-TRE3G-hSpCas9 was constructed by cloning the hSpCas9 open reading frame (ORF), amplified by PCR from pX459V2.0 (Addgene), into pRetroX-TRE3G (Clontech). pVenusA206K-N1 was constructed by cloning the VenusA206K ORF, amplified by PCR from pBS-VenusA206K (47), into the BamHI-NotI site of pEGFP-N1 (Clontech). ..

    Cloning:

    Article Title: Role of the Orphan Transporter SLC35E1 in the Nuclear Egress of Herpes Simplex Virus 1.
    Article Snippet: .. Plasmids. pBS-SEM-KanS was constructed by cloning a kanamycin resistance cassette and the I-SceI recognition site, amplified by PCR from pEPkan-S (71) using primers that additionally encode the tandem strep epitopes-TEV protease cleavage site, 59-GCGAATTCATGGCTAGCTGGAGCCACCCGCAGTTCGA GAAAGGTGGAGGTGCCCGAGGTGGATCGGGAGGTGGATCGTGGAGCCACCCGCAGTTCGAAAAAGGAGGAGG ATGACGACGATAAGTAGGG-39 and 59-GCGTCGACCAAGTCCTCTTCAGAAATGAGCTTTTGCTCACCCTGAAA ATACAAATTCTCTGAACCTCCTTTTTCGAACTGCGGGTGGCTCCACGATCCACCTCCAACCAATTAACCAATTCTG ATTAG-39 into pBluescript II KS(1) (Stratagene). pRetroX-TRE3G-hSpCas9 was constructed by cloning the hSpCas9 open reading frame (ORF), amplified by PCR from pX459V2.0 (Addgene), into pRetroX-TRE3G (Clontech). pVenusA206K-N1 was constructed by cloning the VenusA206K ORF, amplified by PCR from pBS-VenusA206K (47), into the BamHI-NotI site of pEGFP-N1 (Clontech). ..

    Amplification:

    Article Title: Role of the Orphan Transporter SLC35E1 in the Nuclear Egress of Herpes Simplex Virus 1.
    Article Snippet: .. Plasmids. pBS-SEM-KanS was constructed by cloning a kanamycin resistance cassette and the I-SceI recognition site, amplified by PCR from pEPkan-S (71) using primers that additionally encode the tandem strep epitopes-TEV protease cleavage site, 59-GCGAATTCATGGCTAGCTGGAGCCACCCGCAGTTCGA GAAAGGTGGAGGTGCCCGAGGTGGATCGGGAGGTGGATCGTGGAGCCACCCGCAGTTCGAAAAAGGAGGAGG ATGACGACGATAAGTAGGG-39 and 59-GCGTCGACCAAGTCCTCTTCAGAAATGAGCTTTTGCTCACCCTGAAA ATACAAATTCTCTGAACCTCCTTTTTCGAACTGCGGGTGGCTCCACGATCCACCTCCAACCAATTAACCAATTCTG ATTAG-39 into pBluescript II KS(1) (Stratagene). pRetroX-TRE3G-hSpCas9 was constructed by cloning the hSpCas9 open reading frame (ORF), amplified by PCR from pX459V2.0 (Addgene), into pRetroX-TRE3G (Clontech). pVenusA206K-N1 was constructed by cloning the VenusA206K ORF, amplified by PCR from pBS-VenusA206K (47), into the BamHI-NotI site of pEGFP-N1 (Clontech). ..

    Polymerase Chain Reaction:

    Article Title: Role of the Orphan Transporter SLC35E1 in the Nuclear Egress of Herpes Simplex Virus 1.
    Article Snippet: .. Plasmids. pBS-SEM-KanS was constructed by cloning a kanamycin resistance cassette and the I-SceI recognition site, amplified by PCR from pEPkan-S (71) using primers that additionally encode the tandem strep epitopes-TEV protease cleavage site, 59-GCGAATTCATGGCTAGCTGGAGCCACCCGCAGTTCGA GAAAGGTGGAGGTGCCCGAGGTGGATCGGGAGGTGGATCGTGGAGCCACCCGCAGTTCGAAAAAGGAGGAGG ATGACGACGATAAGTAGGG-39 and 59-GCGTCGACCAAGTCCTCTTCAGAAATGAGCTTTTGCTCACCCTGAAA ATACAAATTCTCTGAACCTCCTTTTTCGAACTGCGGGTGGCTCCACGATCCACCTCCAACCAATTAACCAATTCTG ATTAG-39 into pBluescript II KS(1) (Stratagene). pRetroX-TRE3G-hSpCas9 was constructed by cloning the hSpCas9 open reading frame (ORF), amplified by PCR from pX459V2.0 (Addgene), into pRetroX-TRE3G (Clontech). pVenusA206K-N1 was constructed by cloning the VenusA206K ORF, amplified by PCR from pBS-VenusA206K (47), into the BamHI-NotI site of pEGFP-N1 (Clontech). ..

    Single Cell:

    Article Title: Microfluidic devices and methods of use
    Article Snippet: .. For single-cell knock-out clones (HAP1 only), sgRNAs were cloned into modified PX459v2.0 (from Addgene #62988, 1 kb stuffer sequence added). ..

    Knock-Out:

    Article Title: Microfluidic devices and methods of use
    Article Snippet: .. For single-cell knock-out clones (HAP1 only), sgRNAs were cloned into modified PX459v2.0 (from Addgene #62988, 1 kb stuffer sequence added). ..

    Modification:

    Article Title: Microfluidic devices and methods of use
    Article Snippet: .. For single-cell knock-out clones (HAP1 only), sgRNAs were cloned into modified PX459v2.0 (from Addgene #62988, 1 kb stuffer sequence added). ..

    Sequencing:

    Article Title: Microfluidic devices and methods of use
    Article Snippet: .. For single-cell knock-out clones (HAP1 only), sgRNAs were cloned into modified PX459v2.0 (from Addgene #62988, 1 kb stuffer sequence added). ..

    Plasmid Preparation:

    Article Title: Highly efficient prime editors for mammalian genome editing based on porcine retrovirus reverse transcriptase.
    Article Snippet: Weiwei Liu (刘为伟), Wenxin Duan (段 文鑫), Zhiwei Peng (彭志伟), Yaya Liao (廖丫丫), Xiaoguo Wang (王晓果), Ruirong Liu (刘睿容), Qiqi Jing (景琦 琦), Haoyun Jiang (江浩筠), Yuhang Fan (樊煜航), Liming Ge (葛黎明), Lusheng Huang (黄路生), Yuyun Xing (幸宇云) wwliu199@outlook.com (W. Liu), lushenghuang@hotmail.com (L. Huang) xingyuyun9@hotma il.com (Y. Xing).. Trends in Biotechnology, Month 2025, Vol. xx, No. xx https://doi.org/10.1016/j.tibtech.2025.07.029 TIBTEC 2779 No. of Pages 25 OPEN ACCESS Trends in Biotechnology



    Similar Products

    96
    Addgene inc px459v2 plasmid
    Px459v2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459v2+0/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm41844711-210-13-16
    Average 96 stars, based on 1 article reviews
    px459v2 plasmid - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc px459v2 vectors
    Px459v2 Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459v2+0/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/bio_rxiv__64898__2026__03__06__709881-209-16-18
    Average 96 stars, based on 1 article reviews
    px459v2 vectors - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc px459v2
    Px459v2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459v2+0/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm41785087-719-14-16
    Average 96 stars, based on 1 article reviews
    px459v2 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc sp cas9 tracrrna sequence in px459v2
    a Schematic overview of the CHyMErA system illustrating dual-gene targeting and precise exon deletion. Graphical elements were created in BioRender. b , c Overview of the CHyMErA platform and the development of scCHyMErA-Seq. b Diagram of the CHyMErA system enabling multiplexed combinatorial CRISPR screening using <t>Cas9</t> and Cas12a, including elements added for single-cell profiling. c Modifications introduced to enable efficient, simultaneous detection of Cas9 and Cas12a guide (g)RNAs in single cells, including capture sequences (CS), the direct repeat variant 10 (DR v10 ), and the incorporation of the tevopreQ1 riboswitch. d Bar plots showing the proportions of cells with detectable Cas9 and/or Cas12a gRNAs using 10x Genomics droplet-based single-cell profiling. Different hgRNA designs (Fig. 1c) were tested using a standard 10x CRISPR library or a custom Cas12a library preparation workflow. Data are normalized to the total number of cells with detectable gRNAs (see Supplementary Data 1). Data represent mean ± SEM from three biological replicates. e CD46 exon-3 deletion measured by flow cytometry in HAP1 cells transduced with three independent spacer sequence pairs, using the indicated hgRNA designs. Data represent mean ± SEM from biological replicates ( n = 3–9). **** p < 0.0001, *** p < 0.001, n.s. not significant; two-way ANOVA. f Bar plots quantifying the relative expression levels of unprocessed hgRNAs and processed Cas12a gRNAs across different hgRNA designs assessed by northern blotting (see Supplementary Fig. 2a). Data represent mean ± SEM from three biological replicates. **** p < 0.0001, *** p < 0.001, ** p < 0.01, n.s. not significant; one-way ANOVA. g Comparison of As Cas12a DR sequences. The wild-type (WT) DR is shown with the T-rich region highlighted in yellow; DR variant 10 (v10) is shown below, with nucleotide substitutions indicated in red.
    Sp Cas9 Tracrrna Sequence In Px459v2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459v2+0/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pmc12868714-283-16-22
    Average 96 stars, based on 1 article reviews
    sp cas9 tracrrna sequence in px459v2 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc cas9 grna dual expression vector
    a Schematic overview of the CHyMErA system illustrating dual-gene targeting and precise exon deletion. Graphical elements were created in BioRender. b , c Overview of the CHyMErA platform and the development of scCHyMErA-Seq. b Diagram of the CHyMErA system enabling multiplexed combinatorial CRISPR screening using <t>Cas9</t> and Cas12a, including elements added for single-cell profiling. c Modifications introduced to enable efficient, simultaneous detection of Cas9 and Cas12a guide (g)RNAs in single cells, including capture sequences (CS), the direct repeat variant 10 (DR v10 ), and the incorporation of the tevopreQ1 riboswitch. d Bar plots showing the proportions of cells with detectable Cas9 and/or Cas12a gRNAs using 10x Genomics droplet-based single-cell profiling. Different hgRNA designs (Fig. 1c) were tested using a standard 10x CRISPR library or a custom Cas12a library preparation workflow. Data are normalized to the total number of cells with detectable gRNAs (see Supplementary Data 1). Data represent mean ± SEM from three biological replicates. e CD46 exon-3 deletion measured by flow cytometry in HAP1 cells transduced with three independent spacer sequence pairs, using the indicated hgRNA designs. Data represent mean ± SEM from biological replicates ( n = 3–9). **** p < 0.0001, *** p < 0.001, n.s. not significant; two-way ANOVA. f Bar plots quantifying the relative expression levels of unprocessed hgRNAs and processed Cas12a gRNAs across different hgRNA designs assessed by northern blotting (see Supplementary Fig. 2a). Data represent mean ± SEM from three biological replicates. **** p < 0.0001, *** p < 0.001, ** p < 0.01, n.s. not significant; one-way ANOVA. g Comparison of As Cas12a DR sequences. The wild-type (WT) DR is shown with the T-rich region highlighted in yellow; DR variant 10 (v10) is shown below, with nucleotide substitutions indicated in red.
    Cas9 Grna Dual Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459v2+0/px459V2%2E0_Conc2+(Plasmid+%23134451)/med_rxiv__64898__2025__12__23__25342932-35-5-8
    Average 93 stars, based on 1 article reviews
    cas9 grna dual expression vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc px459v2 0 hypacas9
    a Schematic overview of the CHyMErA system illustrating dual-gene targeting and precise exon deletion. Graphical elements were created in BioRender. b , c Overview of the CHyMErA platform and the development of scCHyMErA-Seq. b Diagram of the CHyMErA system enabling multiplexed combinatorial CRISPR screening using <t>Cas9</t> and Cas12a, including elements added for single-cell profiling. c Modifications introduced to enable efficient, simultaneous detection of Cas9 and Cas12a guide (g)RNAs in single cells, including capture sequences (CS), the direct repeat variant 10 (DR v10 ), and the incorporation of the tevopreQ1 riboswitch. d Bar plots showing the proportions of cells with detectable Cas9 and/or Cas12a gRNAs using 10x Genomics droplet-based single-cell profiling. Different hgRNA designs (Fig. 1c) were tested using a standard 10x CRISPR library or a custom Cas12a library preparation workflow. Data are normalized to the total number of cells with detectable gRNAs (see Supplementary Data 1). Data represent mean ± SEM from three biological replicates. e CD46 exon-3 deletion measured by flow cytometry in HAP1 cells transduced with three independent spacer sequence pairs, using the indicated hgRNA designs. Data represent mean ± SEM from biological replicates ( n = 3–9). **** p < 0.0001, *** p < 0.001, n.s. not significant; two-way ANOVA. f Bar plots quantifying the relative expression levels of unprocessed hgRNAs and processed Cas12a gRNAs across different hgRNA designs assessed by northern blotting (see Supplementary Fig. 2a). Data represent mean ± SEM from three biological replicates. **** p < 0.0001, *** p < 0.001, ** p < 0.01, n.s. not significant; one-way ANOVA. g Comparison of As Cas12a DR sequences. The wild-type (WT) DR is shown with the T-rich region highlighted in yellow; DR variant 10 (v10) is shown below, with nucleotide substitutions indicated in red.
    Px459v2 0 Hypacas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459v2+0/pX459V2%2E0-HypaCas9+(Plasmid+%23108294)/pm41496284-39-14-15
    Average 93 stars, based on 1 article reviews
    px459v2 0 hypacas9 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    Addgene inc px459v2 0 hypacas9 plasmid
    a Schematic overview of the CHyMErA system illustrating dual-gene targeting and precise exon deletion. Graphical elements were created in BioRender. b , c Overview of the CHyMErA platform and the development of scCHyMErA-Seq. b Diagram of the CHyMErA system enabling multiplexed combinatorial CRISPR screening using <t>Cas9</t> and Cas12a, including elements added for single-cell profiling. c Modifications introduced to enable efficient, simultaneous detection of Cas9 and Cas12a guide (g)RNAs in single cells, including capture sequences (CS), the direct repeat variant 10 (DR v10 ), and the incorporation of the tevopreQ1 riboswitch. d Bar plots showing the proportions of cells with detectable Cas9 and/or Cas12a gRNAs using 10x Genomics droplet-based single-cell profiling. Different hgRNA designs (Fig. 1c) were tested using a standard 10x CRISPR library or a custom Cas12a library preparation workflow. Data are normalized to the total number of cells with detectable gRNAs (see Supplementary Data 1). Data represent mean ± SEM from three biological replicates. e CD46 exon-3 deletion measured by flow cytometry in HAP1 cells transduced with three independent spacer sequence pairs, using the indicated hgRNA designs. Data represent mean ± SEM from biological replicates ( n = 3–9). **** p < 0.0001, *** p < 0.001, n.s. not significant; two-way ANOVA. f Bar plots quantifying the relative expression levels of unprocessed hgRNAs and processed Cas12a gRNAs across different hgRNA designs assessed by northern blotting (see Supplementary Fig. 2a). Data represent mean ± SEM from three biological replicates. **** p < 0.0001, *** p < 0.001, ** p < 0.01, n.s. not significant; one-way ANOVA. g Comparison of As Cas12a DR sequences. The wild-type (WT) DR is shown with the T-rich region highlighted in yellow; DR variant 10 (v10) is shown below, with nucleotide substitutions indicated in red.
    Px459v2 0 Hypacas9 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459v2+0/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/bio_rxiv__64898__2025__12__09__693120-151-6-8
    Average 96 stars, based on 1 article reviews
    px459v2 0 hypacas9 plasmid - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc plasmid px459v2 0
    a Schematic overview of the CHyMErA system illustrating dual-gene targeting and precise exon deletion. Graphical elements were created in BioRender. b , c Overview of the CHyMErA platform and the development of scCHyMErA-Seq. b Diagram of the CHyMErA system enabling multiplexed combinatorial CRISPR screening using <t>Cas9</t> and Cas12a, including elements added for single-cell profiling. c Modifications introduced to enable efficient, simultaneous detection of Cas9 and Cas12a guide (g)RNAs in single cells, including capture sequences (CS), the direct repeat variant 10 (DR v10 ), and the incorporation of the tevopreQ1 riboswitch. d Bar plots showing the proportions of cells with detectable Cas9 and/or Cas12a gRNAs using 10x Genomics droplet-based single-cell profiling. Different hgRNA designs (Fig. 1c) were tested using a standard 10x CRISPR library or a custom Cas12a library preparation workflow. Data are normalized to the total number of cells with detectable gRNAs (see Supplementary Data 1). Data represent mean ± SEM from three biological replicates. e CD46 exon-3 deletion measured by flow cytometry in HAP1 cells transduced with three independent spacer sequence pairs, using the indicated hgRNA designs. Data represent mean ± SEM from biological replicates ( n = 3–9). **** p < 0.0001, *** p < 0.001, n.s. not significant; two-way ANOVA. f Bar plots quantifying the relative expression levels of unprocessed hgRNAs and processed Cas12a gRNAs across different hgRNA designs assessed by northern blotting (see Supplementary Fig. 2a). Data represent mean ± SEM from three biological replicates. **** p < 0.0001, *** p < 0.001, ** p < 0.01, n.s. not significant; one-way ANOVA. g Comparison of As Cas12a DR sequences. The wild-type (WT) DR is shown with the T-rich region highlighted in yellow; DR variant 10 (v10) is shown below, with nucleotide substitutions indicated in red.
    Plasmid Px459v2 0, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459v2+0/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/us12473572-79-0-5
    Average 96 stars, based on 1 article reviews
    plasmid px459v2 0 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    a Schematic overview of the CHyMErA system illustrating dual-gene targeting and precise exon deletion. Graphical elements were created in BioRender. b , c Overview of the CHyMErA platform and the development of scCHyMErA-Seq. b Diagram of the CHyMErA system enabling multiplexed combinatorial CRISPR screening using Cas9 and Cas12a, including elements added for single-cell profiling. c Modifications introduced to enable efficient, simultaneous detection of Cas9 and Cas12a guide (g)RNAs in single cells, including capture sequences (CS), the direct repeat variant 10 (DR v10 ), and the incorporation of the tevopreQ1 riboswitch. d Bar plots showing the proportions of cells with detectable Cas9 and/or Cas12a gRNAs using 10x Genomics droplet-based single-cell profiling. Different hgRNA designs (Fig. 1c) were tested using a standard 10x CRISPR library or a custom Cas12a library preparation workflow. Data are normalized to the total number of cells with detectable gRNAs (see Supplementary Data 1). Data represent mean ± SEM from three biological replicates. e CD46 exon-3 deletion measured by flow cytometry in HAP1 cells transduced with three independent spacer sequence pairs, using the indicated hgRNA designs. Data represent mean ± SEM from biological replicates ( n = 3–9). **** p < 0.0001, *** p < 0.001, n.s. not significant; two-way ANOVA. f Bar plots quantifying the relative expression levels of unprocessed hgRNAs and processed Cas12a gRNAs across different hgRNA designs assessed by northern blotting (see Supplementary Fig. 2a). Data represent mean ± SEM from three biological replicates. **** p < 0.0001, *** p < 0.001, ** p < 0.01, n.s. not significant; one-way ANOVA. g Comparison of As Cas12a DR sequences. The wild-type (WT) DR is shown with the T-rich region highlighted in yellow; DR variant 10 (v10) is shown below, with nucleotide substitutions indicated in red.

    Journal: Nature Communications

    Article Title: Single-cell exon deletion profiling reveals splicing events that shape gene expression and cell state dynamics

    doi: 10.1038/s41467-026-68774-w

    Figure Lengend Snippet: a Schematic overview of the CHyMErA system illustrating dual-gene targeting and precise exon deletion. Graphical elements were created in BioRender. b , c Overview of the CHyMErA platform and the development of scCHyMErA-Seq. b Diagram of the CHyMErA system enabling multiplexed combinatorial CRISPR screening using Cas9 and Cas12a, including elements added for single-cell profiling. c Modifications introduced to enable efficient, simultaneous detection of Cas9 and Cas12a guide (g)RNAs in single cells, including capture sequences (CS), the direct repeat variant 10 (DR v10 ), and the incorporation of the tevopreQ1 riboswitch. d Bar plots showing the proportions of cells with detectable Cas9 and/or Cas12a gRNAs using 10x Genomics droplet-based single-cell profiling. Different hgRNA designs (Fig. 1c) were tested using a standard 10x CRISPR library or a custom Cas12a library preparation workflow. Data are normalized to the total number of cells with detectable gRNAs (see Supplementary Data 1). Data represent mean ± SEM from three biological replicates. e CD46 exon-3 deletion measured by flow cytometry in HAP1 cells transduced with three independent spacer sequence pairs, using the indicated hgRNA designs. Data represent mean ± SEM from biological replicates ( n = 3–9). **** p < 0.0001, *** p < 0.001, n.s. not significant; two-way ANOVA. f Bar plots quantifying the relative expression levels of unprocessed hgRNAs and processed Cas12a gRNAs across different hgRNA designs assessed by northern blotting (see Supplementary Fig. 2a). Data represent mean ± SEM from three biological replicates. **** p < 0.0001, *** p < 0.001, ** p < 0.01, n.s. not significant; one-way ANOVA. g Comparison of As Cas12a DR sequences. The wild-type (WT) DR is shown with the T-rich region highlighted in yellow; DR variant 10 (v10) is shown below, with nucleotide substitutions indicated in red.

    Article Snippet: To generate the pX462-ABE8e-n Sa Cas9 base editor backbone plasmid (Addgene #237462), we first replaced the Sp Cas9 tracrRNA sequence in pX459v2 (Addgene #62988) with the Sa Cas9 tracrRNA sequence.

    Techniques: CRISPR, Variant Assay, Flow Cytometry, Transduction, Sequencing, Expressing, Northern Blot, Comparison

    a Schematic representation of the lentiviral scCHyMErA-Seq library targeting 224 alternative cassette exons for deletion and 161 genes for knockout. Blue and orange triangles indicate Cas9 and Cas12a target sites, respectively, for each hgRNA category. b Overview of the scCHyMErA-Seq experimental pipeline. Graphical elements were created in BioRender. c , d UMAP visualization of HAP1 cells expressing hgRNAs inducing gene-level knockouts ( c ) or exon deletions ( d ) following linear discriminant analysis (LDA). Insets show UMAPs recalculated after removal of cells associated with the highlighted perturbations in the original plots. Distinct clusters are labeled by the targeted gene or exon. Black dots denote cells carrying hgRNAs targeting other genes, exons, or intergenic controls.

    Journal: Nature Communications

    Article Title: Single-cell exon deletion profiling reveals splicing events that shape gene expression and cell state dynamics

    doi: 10.1038/s41467-026-68774-w

    Figure Lengend Snippet: a Schematic representation of the lentiviral scCHyMErA-Seq library targeting 224 alternative cassette exons for deletion and 161 genes for knockout. Blue and orange triangles indicate Cas9 and Cas12a target sites, respectively, for each hgRNA category. b Overview of the scCHyMErA-Seq experimental pipeline. Graphical elements were created in BioRender. c , d UMAP visualization of HAP1 cells expressing hgRNAs inducing gene-level knockouts ( c ) or exon deletions ( d ) following linear discriminant analysis (LDA). Insets show UMAPs recalculated after removal of cells associated with the highlighted perturbations in the original plots. Distinct clusters are labeled by the targeted gene or exon. Black dots denote cells carrying hgRNAs targeting other genes, exons, or intergenic controls.

    Article Snippet: To generate the pX462-ABE8e-n Sa Cas9 base editor backbone plasmid (Addgene #237462), we first replaced the Sp Cas9 tracrRNA sequence in pX459v2 (Addgene #62988) with the Sa Cas9 tracrRNA sequence.

    Techniques: Knock-Out, Expressing, Labeling